Freitag, 24. September 2010

survival of the sickest




 im folgenden wird sich dieser blogartikel unter anderem den vielen Arten der Pflanzenausbreitung und der chemischen Ökologie anhand konkreter beispiele widmen. (zur wirren ästhetik : ist das chaos in bester ordnung ? dieser
text ist genauso „durcheinander“ wie eine wild wuchernde
wiese eben nicht „durcheinander“ ist. )
zurück
vom verkommenen schönheitsideal, das vorgaukelt, eine gemähte
wiese wäre ästhetisch ansprechender, zum wahren
schönheitsideal: eine wilde wiese ist

eindeutig schöner !

   zurück von der massenindustriellen agrarproduktion zum kontrolliert biologischen landbau im einklang mit der natur !


die
vergessenen
aktivitäten
der intelligenten
pflanzen
(
ES
GIBT KEIN UNKRAUT !!!!!!

und Nützlinge sind Schädlinge je nach Betrachterstandpunkt/Perspektive(click)
Spiralgallenläuse

Spiralgallenläuse

Die Spiralgallenlaus ist für einen Baum keine sehr große Bedrohung, erfahre ich dank der freundlichen auskunft der Gärtner im botanischen Garten, zu dem ich über mehrere zwischenstationen bei friedhofsgärtnereien gelangt bin, die mir alle weitere anhaltspunkte gaben mit denen ich die laus schließlich bestimmen konnte. die pappel hält die laus aus, Marienkäferlarven fressen sie gerne. Die Weibchen haben Flügel.






ökosysteme
regulieren sich selbst.

Selbstorganisation ! Gieße deine(n) Nächste(n) wie dich selbst !?
und wieder sezieren sie und analysieren und zerlegen und trennen und isolieren und züchten und beobachten und beugen sich über ihre bücher und hängen sich an ihre bildschirme, anstatt spazieren zu gehen


K.Bachmann/Biologie
für Mediziner 1976/Mutation als Zufallsprozeß:

"[...]Nach
dem eben Gesagten müssen wir schließen, daß es
keinen erdenklichen Mechanismus gibt, mit dem von der Umwelt oder vom
Bakterium eindeutig entschieden werden kann,

welches
Triplett es gerne an welcher Stelle wie ändern würde.[...]"


.-.

2010: jede vierte pflanze in einem wilden und gesunden wald hat eine Blattkrankheit insofern es Blattkrankheiten gibt und das zählen von pflanzen nicht ein ausdruck von geisteskrankheit ist.

Und auch den zimmerpflanzen ergeht es nicht anders. sie haben rätselhafte krankheiten

wie diese hier zum beispiel der eine ranke in der mitte vertrocknet ist. all diese symptome sprechen metaphorisch für das was in münchen, treffpunkt der individualistInnen mit oder ohne päärchenverhalten, in den mich meine eltern gepflanzt haben, nicht stimmt. und wieder schließe ich vom einzelnen aufs ganze zurück: warum bin ich denn so durcheinander daß ich mich nicht in aller ruhe meinen grünen freundinnen im blumentopf widmen kann, den wesen ohne die wir nicht existieren würden : in dieser permanenten realsatire der sich sozial gebenden münchner regierung , die leider auch sanft und liebevoll tausende menschen unter die erde gepflegt oder in den alkoholismus (und andere krankheiten (aus pschyrembel einfügen) )genötigt hat, mit dem sozialen anstrich der bei näherem hinsehen insbesondere bei schlechter laune auch ab und zu den blick auf ekelhafte egomanen preisgeben könnte, die sich zu verlängerten organen der pharmaindustrie gemacht haben, die nur noch busineß mit krankheiten machen wollen, büttel einer aus der kontrolle geratenen technokratie die so rasend schnell weitermutiert wie die umsätze von leuten die gestern noch keiner gekannt hat.
meine emotionale verbundenheit mit dieser metropole, in form der tausenderlei beziehungen und wunderbaren begegnungen an zig orten erfordert immer wieder eine familienkompatible, demokratische, sozialverträgliche form wie z.B. webdesign, kunst, literatur, musik für meinen ärger über die vielen mißstände.


Diesen Sommer fällt besonders der witterungsbedingt geförderte Pilz Guignardia aesculi auf.




Der Begriff Waldschäden ist ein sachlicher Begriff, der dem technoiden Slang der Mediziner entspricht wenn sie über Körperfunktionen reden

Etwas Grundlegendes stimmt nicht.

und Ökologie bedeutet auch, daß das Ganze von jedem Ort innerhalb des Ganzen aus verändert werden kann.
.-.



in diesem text geht es um das verhältnis folgender begriffe zueinander:

Selbstorganisation
Emergenz
SYSTEMTHEORIE
Tiefenökologie
palynologie
(lehre von den pollen)

mikropropagation
myiophilie (bestäubung durch fliegen)
Hydrochorie
Anemochorie
Semachorie
Ausbreitung (Biologie) Ausbreitungsmechanismen von Pflanzen Samenausbreitung A Adhäsionshafter Adventivpflanze Agochorie Anemochorie Austrocknungsstreuer Autochorie B Ballochorie Ballonflieger Barochorie Blasenflieger Blastochorie Bodenroller Brutkörper Bythisochorie C Chamaechorie D Diaspore Drehflieger E Elaiosom Endochorie Epichorie Ethelochorie F Federschweifflieger Flügelflieger Flügelfrucht Frucht Fruchtfleisch H Haarflieger Hemerochorie Herpochorie Heterokarpie Hydrochorie Hydroepizoochorie K Klebhafter Klettfrucht Kletthafter Klettverbreitung Kollepizoochorie Körnchenflieger M Meteorochorie Myrmekochorie N Nautochorie O Ombrochorie Ornithochorie P Polychorie Polykormon R Regenschwemmlinge Rheochorie S Saatgutbibliothek Saftdruckstreuer Same (Pflanze) Samenhaar Samenschale Schirmflieger Schraubenflieger Schuttvegetation Selbstausstreuer Semachorie Speirochorie Steppenroller Stolo T Telechorie Teufelsgarten Tierballisten Tierstreuer Topochorie V Vegetationsdynamik Versteckausbreitung W Wasserhafter Wind- und Tierstreuer Windflieger Windstreuer Wintersteher Z Zoochorie

Zoochorie

Autochorie
Endozoochorie

Speirochorie

Agochorie
Barochorie
Kletthafter
morphogenetische felder
Adhäsionshafter
Klebhafter

Endochorie

Myrmekochorie,

Ornithochorie

Dysochorie
Synzoochorie
Bearbeitungsausbreitung
Nautochorie
Bythisochorie
Ombrochorie
Regenschwemmlinge
Regenballisten
Ballochorie
Herpechorie
Barochorie
Blastochorie
Ethelochorie
Speirochorie
Agochorie
Endozoochorie
Epizoochorie
Ektomykorrhiza
Myrmekochorie
urkost
lernprozeß
pflanzenkollektive

Verbreitungstechniken
Ausbreitungsökologie
Agrarökologie
landwirtschaft
ökologischer landbau
organic farming
Dünger
pflanzenvereine
austrocknungsstreuer
pheromonengeruch als schutz
suizidkeimung (z.B. fichten mit sehr vielen zapfen)

epigäische keimung
hypogäische keimung keimung
keimdauer
keimtypen
gymnospermen
angiospermen
sproßachsen
hyphe
keimblätter
sämlinge
wirtsspezifität

IUCN 

Geoökologie

Ökologismen
Biologismen
Landschaftsökologie
Popularität
Häufigkeit
Seltenheit
Ausgestorben
Vom Aussterben bedroht
Keimfähig

Chorologie

Synchorologie

Arealkunde
Strain hunters
Seed hunters
industriemelanismus
zivilisationsfolger
ganzheitliches Denken 
zusammenhänge 

modifikation
metabolamics
neophyten
pflanzenphysiologie
zellbiologie
phytohormone
phytomedizin
kreativität
creare
fauna
flora
ultrastrukturforschung
vegetationsökologie
protoblasten
zoosporen
konidien
regeneration
koleoptil
biotop
geotop
staudengärtnerInnen
stadtgärtnerei (eduard schmid straße)
zellarchitektur
zellkultur
paläobotanik
biodiversifikation
synergetik
synergie
ecoinformatics
intelligent design
biodiversizität
kontexttheorie
kontextualismus
polykontexturalität
systeme
strukturen
saatgutbibliothek 
ranken

pagerank
pollenanalyse
dickicht
green IT
suchmaschinenmonokulturen (z.B. googles suchmaschinenmarktanteil um die 80%)
vielfalt
artenvielfalt
biotope
mobilität
statisch
competition
cooperation
symbiosen
mykorrhiza
kreationismus
parasiten
biologische schädlingsbekämpfung
Pflanzengallen
darwinismus
evolutionstheorie
Schnelle Zellregeneration
evolution
revolution
involution
devolution
Biozentrismus(und kritik daran)
Naturtheologie
Biosoziologie (und kritik daran)
Soziobiologie (und kritik daran)
Holismus
umweltsoziologie
koexistenz
paläobiologie
paläoökologie
mikroorganismen
saatguthandel
biomaten
stigmergie
symbiosen
biologie
basenpaare
replikation
mutation
selektion
rekombination
veränderung
paracelsus
hippokrates
franz konz
metabolismus
fluktuation
diasporen
protisten
umweltpsychologie
vernetzung
liebe
morphismen
morphologie
schamanismus
synthesen
sozial
kletten
systembiologie
kybernetik
Calycobolie

Synaptospermie.

Aestatiphorie

Basikarpie
Geokarpie
mixed reality
augmented reality
regulation
ökologie
ökotrophologie
fusionen
wurzeln
stengel
blätter
photosynthese
stoffwechsel
dünger
knoten
wirkungsgradienten
komplexität
geflecht
gebüsch
egger/herde der rede
myzele

schimmelpilze

sporen
interaktion
tierrechte
tierethik
tierschutzgesetze
photobionten
ethnobotanik
ethnopharmakologie
rainbowfamily/welcome home
nativeweb
urwurz
coica
coiab
angryindian.blogspot
cleve backster
castaneda
wurzelsepp
system
synchron
symbol
genetik
superunkräuter
biotech crops
neobiota
hildegard von bingen
pettenkofer
endemiten
flechten
attraktoren
Meteorochorie
windbestäubung
Anemochorie
Ökosystem
biosphäre
raubbau der menschen
green IT
artensterben
vielfalt
ranken
pollenanalyse
saatgutbibliotheken
dickicht
evolutionssimulation
inselgigantismus
tierbestäubung
flugsamen
pollenflug
selbstbestäubung
darmwanderer
evolutionsalgorithmen
paarung
Bionik

(grafik von http://www.grintsch.com fuer henkel, die eine bionische hand abbildet, ueber die eine platine gelayert ist)


populationsdynamik






diese
wörter verkörpern jeweils ein bewußtsein.

Sind
allesamt im www recherchierbar, die hierzu verfügbaren
datenmengen

Füllen
garantiert tausende bibliotheken.



ist
es nötig das noch weiter zu veranschaulichen?


created using http://wordle.net

vielleicht
macht das sogar spaß diese datenmenge hier jetzt durch

ein
programm zu schicken, zu einem blogartikel zu machen,

zu
visualisieren, 3dimensional zu visualisieren, in klänge
umzuwandeln (auch das noch ???? synästhesie ???? zuviel des guten),


created using http://wordle.net
mit
algorithmen zu verändern.


created using http://wordle.net




( Schriftzug "EMPIRE" als Graffitti im Organic-style von Theo Aartsma, siehe http://www.typegoodness.com/wp-content/uploads/2009/09/theo_aartsma_1.jpg )

am
besten wäre es, das den wörtern selber zu überlassen,

ähnlich
wie in einem großen blumenkasten im freien wo alle lebewesen
darin wie pflanzen

guten morgen liebe mitbewohnerin nett daß du dich mal zeigst
milben
bakterien würmer fliegen drosophila schnecken 


käfer läuse
ameisen je nachdem ob es wörter dafür gibt bzw. ob aus
welchem bewußtsein diese wörter kommen

sich
selbst überlassen werden oder aber auch gegossen, besprochen,

gedüngt,
beschnitten oder aber einfach wachsen gelassen werden

von
wesen die ja zum selben system dazugehören.

Informationsweitergabe:
Ein Marienkäfer fliegt durchs offene Fenster zwischen Pflanze und Scheibe,
lernt etwas über Glasscheiben,
erforscht dann die Wand,
nicht die Pflanze,
ein zweiter Marienkäfer fliegt außen am offenen Fenster vorbei.
Der Marienkäfer innen fliegt nicht wieder raus, sondern erforscht die kante über dem Fenster.
Die wissen schon, was sie tun.
Die Spinnmilbe wusste schon warum sie sich 20 minuten lang nicht fangen ließ.
Es war extrem dumm von mir sie trotzdem zu fangen auch wenn ich schon gemerkt hatte dass sie meinen fingern ausweicht.
Außerdem war es sehr anstrengend.



verhalten sich die hier zusammengestellten botanischen bzw. ökologischen begriffe
ähnlich wie die versprachlichten verhältnisse, pflanzen und
verbindungen selber? 

wie ist es denn überhaupt möglich daß sich bestimmte spezies so stark durchsetzen und andere unterdrücken ?



Zum
Beispiel:

Grafisch
visualisiert würden die Chorien-Wörter für vermehrung
sorgen, bestimmte wörter ließen sich grafisch verbinden,

alle
wörter zusammen würden ein größeres Ganzes
bilden, ein komplexes Etwas .

Bestimmte
begriffe würden beginnen an anderen zu knabbern, andere würden
sporen austreiben und sich aussäen und mit vielen tricks
vermehren um häufiger vorzukommen odgl.

„Materie“ lebt.
Kristalle wachsen und schwingen.
Die „feste Phase“ schwingt.




das
einleitende zitat zum beispiel würde ziemlich bald (schnell)
vergammeln (also biologisch umgebaut werden) weil es aus dem
tierversuchshaltigen kontext der genetik stammt, ebenso wie die
dokumentation der brutalen stabheuschreckenversuche der kybernetiker
des jahres 1979



die
begriffe die einen brutalen umgang mit pflanzen implizieren,

würden
von anderen begriffe aufgefressen werden




was
machen wörter in elektronischen strukturen von sich aus ?

sind
es wirklich nur in diesem fall digital abgespeicherte
buchstaben-anordnungsvorschriften innerhalb von programmierern festgelegter regeln?

(buchstaben
buchenstäbe)



Wie
lässt sich das grafisch verdeutlichen was ich meine,

wenn ich der tendenz entgegentreten will, daß mengenmäßig betrachtet viel zu viele nebensächliche themen ständig wiederholt werden,
dann
bedeutet das den ausgestorbenen,

seltentsten
und bedrohtesten wörtern und pflanzen

einen angemessenen platz
inmitten der milliarden populäreren zu schaffen. werde ich dafür kritik ERNTEN ?

created using http://wordle.net


Hier
lässt sich sogar ein zusammenhang von SEO bzw. information
retrieval oder qualitätsanalyse zu botanik konstruieren !!! hoffentlich ist ein browser kein rasenmäher !

(wie konnten sich denn diese wahnsinnigen gärtner und gartenbaufirmen so stark vermehren die jahr für jahr gigantische ökosysteme abmähen!?) 
(warum bekommen manche seltsamen seiten tausende klicks pro tag und andere nur wenige seitenbesuche im monat?) 
das von G gekaufte doubleclick ist spyware, hunderttausende haben diese tracking cookies installiert ohne es zu wissen.hunderttausende computer sind allein durch adware und spyware miteinander verbunden, das visualisieren von elektronischen netzwerken zeigt überdeutlich strukturen die wir aus der natur kennen 
am beispiel nofollow lassen sich marktmechanismen betrachten, meta tags spielen DOCH eine rolle usw.
von über 100 verschiedenen samen aus der natur und aus obst und gemüse aus supermärkten
wachsen einige ziemlich schnell und kräftig, andere gehen ein oder entwickeln sich eher langsam

die schefflera arboricola hier zum beispiel, in münchen oft gesehen, eine tropenpflanze, meine kleine die ich (als jemand der sich jahrelang geweigert hat sich zimmerpflanzen in die wohnungen zu stellen weil er die blumentöpfe als gefängnisse empfunden hat) , von der straße, auf der sie im umgekippten zustand gelegen war, gerettet hatte im vorbeigehen, sie, mit der das alles angefangen hat, sie, der 4 triebe an ihrer spitze verkümmert waren, hat jetzt (viele monate später) plötzlich angefangen ganz unten auszutreiben.
hoffnung





da
web-suche sehr stark über die sprache funktioniert, ist hier
auch der zusammenhang von linguistik zu botanik relevant, d.h. das
für die botanik so typische Bestimmen.



(und was
in der botanik das bestimmen ist, wäre in der medizin das
diagnostizieren, das sich festlegen lassen auf ein vorgefertigtes denkmuster)



Warum
setzen sich so oft völlig nebensächliche themen durch.


Erkennbare
analogie: warum werden jahr für jahr so viele arten ausgerottet
und bedroht, dass jemand der sich mit dem iucn bzw. den aktuellen
topics von pflanzenschützern beschäftigt, merkt, dass hier
ein wettlauf gegen die zeit stattfindet, der auch im anlegen von
immer mehr und größeren genbanken und saatgutbibliotheken
besteht, obwohl es doch viel effektiver wäre sämtliche für
das aussterben der arten vorhandenen gründe zu beseitigen !



der widerstand gegen genverändertes saatgut

wächst

immer mehr menschen stehen gegen die bestrebungen von konzernen wie monsanto auf, pflanzen und saatgut genetisch zu verändern, zu patentieren und die agrarwirtschaft immer stärker in eine massenindustrie zu verwandeln

aus der sicht eines evolutionsbiologen sind alle lebewesen der ständigen mutation unterworfen, sowohl die biochemiker in den gentechfirmen als auch die leute, die dagegen protestieren als auch die pflanzen die diese ganzen leute essen. aus seiner sicht wären die gravierenden eingriffe der gentechniker ebenfalls teil der evolution. und auch wenn ich nicht viel darüber weiß, ist es schon etwas unheimlich daß genverändertes gemüse und getreide schon seit ca. 10 jahren angebaut und konsumiert wird. Viele Kühe, die Gensoja oder Genmais gegessen haben sind gestorben, Hasen auch, Familien von Bauern die so etwas angebaut hatten wurden schwer krank. Außerdem werden insgesamt doch wieder mehr Pestizide eingesetzt und Superunkräuter entstehen. Die großen Anbieter von genetisch verändertem Saatgut beschönigen die schlimmen Auswirkungen auf Menschen, Tiere und Pflanzen. Immerhin gibt es einige Gegeninitiativen.
Wenn wir uns anschauen wie die Menschen mit ihrer teilweise maßlosen Arroganz und Definitionsmacht, die sie nicht wirklich haben, lebendige Ökosysteme völlig aus dem Gleichgewicht gebracht haben, millionen Tiere umgebracht und versklavt haben, zehntausende Quadratkilometer über lange Zeiträume herangewachsene Wälder vernichtet und zubetoniert haben, und immer noch so tun als wüßten sie genau was sie tun,
kommt man sich vor wie permanent im falschen film.






erinnert sich jemand an pierre ouellette und seinen gentech scifi thriller "die deus maschine" ?

oder an filme wie AEON Flux oder Gattaca oder Code 46 ? An "Mutation" (Crime Zero) von Michael Cordy ? "Computerfiktionen" von Thomas Kaltenbach und Thomas Woerrlein ?
auch im schockwellenreiter von john brunner (shockwaverider) sind einige bezüge zur gentechnik zu finden : die geschichte von miranda ist einer der vielen handlungsstränge die sich durch diesen cyberpunk thriller ziehen
it had a face. It had a torso. It had one normal-looking hand set straight in at the shoulder, one withered hand on the end of an arm straw-thin and almost innocent of muscle, and no legs. It rested in a system of supports that held its overlarge head upright, and it looked at him with an expression of indescribable jealousy. It was like a thalidomide parody of a little girl.
Portly, affable, Bosch chuckled at his visitor's reaction. "That's Miranda," he explained, dropping into his own chair. "Go ahead, stare all you like. She's used to it - or if she isn't by now, then she's damned well going to have to get used to it."

"What... ?" Words failed him.

"Our pride and joy. Our greatest achievement.[...]genetic element of wisdom[...]"Then let me lay this on you. If you hadn't met Miranda - if you hadn't found out that our suspicions concerning the genetic component of personality were being verified by experiment - would you have deserted from Tarnover?"[...]Ferdie Squibbs, his son (electronics maintenance and amateur plant genetics)[...]Judging by what happened subsequently, his claim infuriated nearly as many people as did the news that there are only four elements in the human genetic code.[...]AN ALARMING ITEM TO FIND ON YOUR OVERNIGHT MAIL-STORE REEL

Origin: Tarnover Bioexperimental Laboratory

Reference: K3/E2/100715 P

Subject: In-vitro genetic modification (project #38)

Nature: Controlled crossover in gamete union

Surgeons: Dr. Jason B. Saville, Dr. Maud Crowther

Biologist i/c: Dr. Phoebe R. Whymper

Mother: Anon. volunt. GOL ($800 p.w., 1 yr.)

Father: Staff volunt. WVG ($1,000, flat pmt.)

Embryo: Female

Gestation: - 11 days

Survival time: appx. 67 hr.

Description: Typical class G0 and G9 faults, viz. cyclopean eye, cleft palate, open fontanelle, digestive system incomplete, anal-vaginal fusion, pelvic deformities and all toes absent. Cf. project #6.

Conclusion: Programed inducement of crossover only partially successful employing template solution #17K.

Recommendation: Repeat but attempt layering of template on crystalline substrate (in hand) or use of gel version (in hand).

Disposition of remains: Authorized (initialed JBS).




es hat sich herausgestellt daß der ausspruch "survival of the fittest" gar nicht von dem rassisten und ehemaligen christen charles darwin stammt. auch wenn er zu einem falsch verstandenen "machet euch die erde untertan" passen würde.
(c)Spektrum Verlag, entnommen aus "Cyberbionic" von Tobias Gremmler
da gibt es viele heiße diskussionen zwischen bäumen, tieren, leuten, personen, menschen, kreationisten, soziobiologen, biologen, undsoweiter. immer wieder begegnet einem Richard Dawkins, dessen Meme visualisiert wie ein riesiges Gestrüpp aussehen. Zitat Dawkins aus "das egoistische Gen": "Wir sind Überlebensmaschinen" "Ein Affe ist eine Maschine". Das ist genau die Einstellung, mit der Tierquäler in Labors ihren Sadismus rechtfertigen wollen. Die Geschichte der Genetik ist eine Geschichte der Folter. Sadistische Schizophrene mit Doktortiteln, hausend in ihrer selbstgeschaffenen Terminologie, leben ihre kranken Triebe an Versuchstieren aus und nennen die daraus gewonnenen Erkenntnisse "Wissenschaft". Brutale Faschisten unter dem wissenschaftlichen Deckmäntelchen behandeln Geschöpfe mit Seele und Verstand wie Sachen mit Nummern. Aber wie ich finde spielt Richard Ryder, ein Psychologe der sich nach seiner tätigkeit in versuchslaboratorien der tierrechtsbewegung anschloß, eine mindestens genauso große Rolle. das Manko der Biologie ist, daß sie von Anfang an brutal ist und dem Menschen stets die höchste Priorität einräumt, das leben auf dieser erde fast ausschließlich aus der perspektive der menschen betrachtet.
die evolutionstheorie ist schon über 2000 jahre alt.
muß ich jetzt darüber schreiben obwohl ich in bio kaum aufgepaßt habe früher und mich nicht gut auskenne damit ? ist es ein genetisches programm ?
EVOLUTION-
Survival of the asshole
Survival of the social
Survival of the
;;;;;;::;:;:;:;;:;:;:;;;;;;;;;;;;;;;;::;::;:;;:;::;:;::;:;:::;::;:;::::::::::::::::::;:;:;;::;


mal in den suchmaschinenrankings schauen, ob sich wieder lügen gegen wahrheiten durchsetzen können ?
das geht eigentlich nicht: ein guter algorithmus sorgt schon für so etwas ähnliches wie objektivität oder ?
entsprechend zum ausrotten vieler arten ist schon so etwas wie eine suchmaschinenmonokultur entstanden, wenige große beherrschen den suchmaschinenmarkt.

ich kann mir gut vorstellen wie die schöpfungslehre, aus einer raum und zeit übergeordneten ebene kommend, sich in keinster weise mit einer evolutionstheorie widerspricht.


¶¥?????¦¦¦¦¦????¶¥?????¦¦¦¦¦????¶¥?????¦¦¦¦¦????¶¥?????¦¦¦¦¦????¶¥?????¦¦¦¦¦????¶¥?????¦¦¦¦¦????

eine
pflanze blüht, schon zum zweiten mal dieses jahr, kräftig
groß und rosa.

werden
insekten die ihr vielleicht helfen könnten sich fortzupflanzen

sie
durch die fensterscheibe sehen ,

ihre
pollen mitnehmen ?

die hauswurz (eine sukkulente) hat auch eine zeitlang geblüht ....hat ihr das was gebracht ?

die (süßkartoffel?) hatte irgendwann keine kraft zu stehen und ist ins zimmer rein gekippt also habe ich sie festgebunden. so hat sie sich bis an die decke raufgerankt obwohl da oben kein licht ist und angefangen gelb zu blühen.
jetzt ist sie schon wieder umgekippt. sie wächst und wächst. ist sie eine tomate ?
innerhalb von 2 monaten ist die eine um das doppelte gewachsen.
die pflanzen wollen natürlich ALLE optimale lebensbedingungen,
d.h. sie nutzen auch JEDE möglichkeit um OPTIMALE lebensbedingungen zu bekommen.
Mal sehen wie sie das machen in zukunft.

so
vieles ist für mich ein mysterium.


ich
baue auf die geheime intelligenz der biologischen systeme.

vieles
davon habe ich noch gar nicht verstanden.

eine
aus dem supermarkt vor dem essen gerettete


wurzel ist ausgetrieben
und knapp einen meter

groß,
sie hat um die 50 kleine blüten.

wie
lernt sie jetzt, für wen blüht sie, locken ihre pheromone
die viecher an die

(??????)
was
mache ich das nächste mal im botanischen garten wo ich einige
male war ohne

das
und das zu wissen ?

werde
ich dort mit pheromonen markiert ?

ein
bestimmter vogel gibt ein bestimmtes signal genau zu dem zeitpunkt wo
ich

etwas
bestimmtes herausfinde.


küsse
zwischen menschen und menschen und küsse zwischen menschen und
hunden dienen auch noch einem anderen zweck als der zuneigung :

mikroorganismen-weitergabe


sie
versuchen sich jetzt optimale lebensbedingungen zu schaffen, UND MEHR
: mir auch, dir auch, uns auch – ich bin in diesem system mit
drin,

da
ich in der wohnung wohne, unmittelbar angeschlossen ,

ich
bin noch der wasserversorger

(GIESSE DEINEN NAECHSTEN WIE DICH SELBST ?! hallo, das soll selbstorganisation sein ?)
und der der ab und zu losgeht

um
dieses oder jenes für den großen blumenkasten mitzubringen

in
der erde schlummern EINIGE verkapselte pflanzencodes

von
vielen orten in 20 kilometer umkreis die möglicherweise

20
jahre keimungsfähig bleiben d.h. dort warten ,

und
JETZT BEREITS von mikroorganismen untersucht werden,

die
information wird weitergegeben,


netzknoten
zur außenwelt sind:


-mikroorganismen
aus dem leitungswasser oder kräutertees die ich hineingieße


-eine
webcam mit indirektem netzzugang je nachdem


-das
gekippte oder ganz geöffnete fenster


-membranen
in den blättern wurzeln und blüten


-die
Drosophila Schwarmintelligenz die sich dort ebenso plötzlich und
überraschend eingefunden hat wie stubenfliegenbesuche, gerettete
und wieder im park ausgesetzte schnecken,

kot
(mit information darin) einer geretteten taube unter schockzustand,
die sich eine nacht bei mir ausruhen durfte bevor ich sie wieder
freiließ (foto im archiv des hallo sendling)

ameisen,
würmer, kleine milben die auf dem haus einer toten schnecke
krabbelten und FAST NUR DA (wo kamen die aufeinmal her, und
verschwanden wieder)

das
wochenlange verschwinden der einen schnecke

und
sie dann lebendig wieder finden in der ecke der werkzeugkiste

geschützt
von der selbergemachten membran am schneckenhauseingang


wie
sich die schnecken wochenlang an bestimmte blätter von
bestimmten pflanzen hängen

(snails drink beer.....)
1982: Anlocken mit Bier in diesen grünen plastikuntersetzern dann in den Wald gebracht die Nacktschnecken, nicht umgebracht!
23.10.2010 :Ich stelle der gerade aufgewachten (Bänderschnecke?) ein Schälchen frisches Münchner leitungswasser hin, ein Wasser das zu den besten Heilwassern und Mineralwässern dieses planeten zählt(e). Sie kriecht daran vorbei. Schnecken was zu trinken geben ß schwierig.
übergieße ich das System, beginnts zu schimmeln. wie merke ich wann ich gießen muß: mit dem Finger in die Erde langen, wenn sie trocken ist, gieße. 
-
Schnecken lieben glatte Flächen. Schnecken lieben nasse Flächen. jemand hat im web geschrieben sie essen gerne karotten. jetzt ist sie auf die karotte geklettert und runtergefallen.sie hat ihr haus an den kaputten stellen geleckt. ich werde sie wieder zurück in den park bringen obwohl sie dort in akuter lebensgefahr durch dumme tramplige menschen und fahrradfahrer und nachtspaziergänger wie du und ich ist. ihr haus ist schon ganz schön lädiert von der zeit im park deshalb habe ich sie auch gerettet. wie FÜTTERN ? die schnecken haben nur ein kleines bißchen gurke gegessen, der mangold ist verwelkt ohne daß sie ihn angerührt haben, nur draufgesetzt hat sich die eine kleine weil die blätter so schön glatt sind. die haferflocken wollten sie auch nicht essen. nach einem winter auf meinen topfpflanzen hab ich sie an einer stelle mit vielen anderen schnecken dann wieder im park ausgesetzt. hoffentlich haben sie was gelernt.auf jeden fall hab ich von ihnen auch einiges gelernt nachdem ich sie mehrere monate beobachten konnte
-
Messestadt Riem mies van der rohe neubauviertel 6/2010:
ein nasser Teerweg. hundert Nacktschnecken kriechen los, auf dem Weg auf die andere Seite, wissend daß es ein von Fahrradfahrern stark befahrener Teerweg ist. die meisten werden plattgefahren, wenige schaffen es bis auf die andere Seite.
Schnecken verfügen über gut entwickelte sensoren aller Art: geruch, wärme, sympathie, antipathie, telepathie. schnecken sind Yogis. schnecken meditieren viel.
diese Situation 2008 2009 2010 in hundertfachen varianten auf münchner teerwegen, gehwegen, bürgersteigen, wegen in parks. sie kriechen einfach los, viele werden zertreten. im dunkeln beim parkspaziergang machts dann manchmal dieses traumatische "knirsch". muß das sein ?

10/2010 :
wanderungen .....

______________________________________________________
______________________________________________________
wie
reagieren sie, die pflanzen, die fliegen,

auf
die laufende kamera ?

benutzen
sie sie für weitere strategien , als möglichkeit bestimmte

signale
an bestimmte orte zu bringen ?


inwieweit
ist mein denken durch das übernachten im zimmer der pflanze

schon
unseren absichten also den absichten der pflanzen und mir nach

verändert
?





Nach
den erkenntnissen von backster(bzw. seinem lehrer
Jagadish Chandra Bose )

können
pflanzen nicht nur bestimmte menschen voneinander unterscheiden,

nehmen
genau wahr, wenn brutalität um sie rum geschieht

backster
lässt eine vorrichtung kleine fischchen in kochendes wasser
kippen, und im selben moment zeichnen die an blättern von
pflanzen befestigten elektroden

einen
heftigen ausschlag auf.

Jemand
kommt in einen raum und verdrischt eine pflanze und die
nachbarpflanze

Erinnert
sich an genau diese person: messbar am ausschlag eines elektronischen
meßinstruments.

das
heißt, pflanzen ziehen konsequenzen aus dem sensorisch erlebten
im hinblick auf bestimmte personen?


https://sensiblochamaeleon.blogspot.de/2013/12/seelenleben-und-musikalitat-von-pflanzen.html 

(...................)

Dann
lieber bei den yanomami weiter, die zum beispiel

In
der blackbox des gasteig am rosenheimer platz persönlich
vorbeischauten

Und
dort mitgebrachte kräuter verschenkten, auskunft gaben

Das
sind die leute mit dem wissen das uns zuvielisierten verschütt
gegangen ist.



Ich
fühle mich wohl im botanischen garten sehr wohl.

bis
darauf daß einige fische dort von mehr Freiheit träumen,

wie
auch sämtliche von Zoohändlern und Gartenbaumärkten
verkaufte Tiere.

sämtliche tierhändler dieses planeten gehören so lange in therapieanstalten bis sie begreifen daß sie fühlende wesen mit verstand unschuldig eingesperrt haben, ohne vernünftigen grund.
 pflanzen
ziehen konsequenzen aus dem sensorisch erlebten im hinblick auf
bestimmte personen


Zurück
zum ausgangspunkt dieses essays:

Inwieweit
schafft sich die dem sich ständig verändernden lebewesen
sprache und auch den ständig mutierenden selektierenden und
rekombinierenden metabolismen der pflanzen und myzele innewohnende
seele selbst wieder die optimalen bedingungen,die sie braucht,

ähnlich
wie in „little shop of horrors“

die
ursprünglichen lebensbedingungen vor der einschränkung
durch technokratisierung durch die menschen (trennen, hinter glas
stellen, analysieren, auf objektträger, sezieren, beobachten,
besitzen wollen, parzellieren, vom ökosystem isolieren):


da
tu ich mir schwer: seele ? wesen ? intelligenz ? bewußtsein?

Wie
schreib ich das .


………………………………………………………………………………………………………………………………….


The
function of genoms is only partially understood

Fotogen
mutagen telegen

………………
Verbreitungswege
von $%/$($/$§%$§
¢ª◦♫‰ђфζщω¦&/$%(§%&§$%(&/
Gartenzwerge
>saatidee>

Frage
der zweckgebundenen Ästhetik von Pflanzen:

Männer
und Frauen machen sich nicht nur deshalb schön,

weil
sie sich später fortpflanzen wollen

und:
Blüten
Schönheit auch im Kopf entsteht

……………………………………………………….
Immer
mal wieder taucht das Wort“programm im zusammenhang mit
pflanzenmetabolismen auf

Die
entstehung der Mitochondrien ungeklärt/ „die erde ist
nicht alt“

(Zum
beispiel für jemanden für den 1000 jahre so lang wie eine
sekunde sind)

…………………………………………………………………

Wie
reagieren „meine“ pflanzen

Auf
das gefilmtwerden



Kann
die kamera das ersetzen was die fensterscheibe verhindert ?

Woran
merke ich wann die pflanzen DURST haben.

Durst
ist ein menschenwort im menschendenken.

Wenn
der wasserstandsanzeiger auf optimal steht
?

Wenn
ich spüre dass die erde nicht mehr so feucht ist

?
Wenn
ich ein gutes gefühl beim nachlitern habe

_?______________________________________



Eine
kleine Wespe verkuppelt Feigenbäume miteinander, selbst wenn sie
mehr als hundert Kilometer voneinander entfernt stehen. Trotzdem
erledigt die Feigenwespe den Pollentransport für die Bestäubung
mitunter in beeindruckender Geschwindigkeit –mit hilfe des
windes.



Die Wespe die bei mir die letzten zwei tage zwischengelandet war, für die wespen im herbst typischerweise ziemlich verwirrt und außer kräften, ist vorhin kreiselnd weitergeflogen, nachdem sie auf dem teppich nur noch im kreis herum gelaufen ist,aufgepeppelt mit spekulatius und honigwasser (was sie nachts im miniökosystem gemacht hat weiß ich nicht, sie ist mir auch nicht in den mund gekrabbelt wie die wespe die mal über einen keks bis zu meiner zunge transportiert wurde )
früher haben wir die wespen die uns am kuchenessen gehindert haben, mit einem pumpzerstäuber voller wasser besprüht. sie haben sich dann kurz woanders zum flügeltrocknen hingesetzt und sind weitergeflogen.

 (.........)

schade, daß so viele dachdecker chemospray gegen wespennester unter dachziegeln anstelle von ((   )) dabei haben. naja.



Millennium Seed Bank Project (MSBP)

http://www.kew.org/science-conservation/conservation-climate-change/millennium-seed-bank/index.htm
...............,.,...,.,,,..,.,...,.,,.....,,,,,...,,.,,....,.
petition am bundestag gegen das verkaufsverbot von heilpflanzen durch die EU
_______________________________________________________________________________




Nähe
spitzbergen:


1,5
Millionen Pflanzensamen sind bereits sicher verschlossen - 4,5
Millionen Samen passen hinein. Knapp 70.000 Reissorten und ca. 15.000
Bohnensorten werden bei minus 18 Grad Celsius gelagert. Pflanzen wie
Reis, Weizen oder Gerste soll auf Spitzbergen vor Verlusten geschützt
werden. Der Tresor selbst ist gesichert wie Fort Knox. All überall
Kameras, Bewegungsmelder, Sicherheitspersonal.


http://de.wikipedia.org/wiki/Welttreuhandfonds_f%C3%BCr_Kulturpflanzenvielfalt
http://de.wikipedia.org/wiki/Svalbard_Global_Seed_Vault
http://seedwarriors.org/
http://commons.wikimedia.org/wiki/Category:Svalbard Global Seed Vault
film darüber auf youtube


http://www.portfolio.com/interactive-features/2007/10/seed_bank/

CGIAR


in dieser von
weltweit 1400 genbanken geht es in erster linie

um Nutzpflanzen.


Ort:
in norwegen

Seedhunters
sind schon unterwegs auf diesem planeten !!!!



Ihnen
geht es um das bewahren und das schützen….

Gut, aber,
Wäre es nicht direkter, alle maschinen zu stoppen, 
die Pflanzen bedrohen ?


Aufzucht
bedrohter arten mit hilfe von zellen aus herbarien

In vitro/ per zellkultur /in petrischalen auf agarplatten ?
(irgendwie umständlich, lieber gar nicht erst die bedingungen schaffen,
die zum aussterben von pflanzen führen)


http://www.iucn.org/
http://www.geobotanik-frankfurt.de/
http://www.biologie.de/cms/
http://pbil.univ-lyon1.fr/Ecology/
http://www.bgbm.fu-berlin.de/BioDivInf/Docs/BinD/Bib.htm
http://www.cbd.int/
http://www.ub.uni-siegen.de/cgi-bin/systeil.pl?nota=VNA-VTW
http://www.catalogueoflife.org/annual-checklist/2010/browse/tree


[strain
hunter]



!!! netenalp med fua sgewretnu nohcs dnis sretnuhdees

3=inu&92C2%62C2%42C2%22C2%82C2%72=seirogetac_detseggus&soediv=epyt_hcraes&sknab+dees=yreuq_hcraes&m=dedaolpu?stluser/moc.ebutuoy.www//:ptth
http://www.youtube.com/results?uploaded=m&search_query=seed+banks&search_type=videos&suggested_categories=27%2C28%2C22%2C24%2C26%2C29&uni=3

seed
banks……..



http://de.wikipedia.org/wiki/Saatgutbibliothek

http://www.bdp-online.de/de/Homepage/

http://www.worldseed.org/isf/home.html

http://www.ipk-gatersleben.de/Internet


paläobotanik
links

___________________
http://www.equisetites.de/search1.html#Inter
http://www.equisetites.de/palbot1.html

http://www.paleobot.org/

http://www.vfp-archaeologie.uni-muenchen.de/ueber_uns/vorfruehg/palaeo/index.html

http://www.palaeo.de/



paläobiologie-paläoökologie




wieder
zurück zu den ausbreitungstechniken und tricks :

"aussaat
vom flugzeug aus"

anzucht
bedrohter arten aus herbarien mit zellkulturen????

Zu
umständlich, wirre science fiction-idee

Danke
dass sie mich sogar schreiben lassen

Und
denken darf ich

Heiii
yippie denken und schreiben ist noch nicht verboten


tier
(auch fische) isst verpackten samen

und
transportiert ihn im verdauungstrakt kilometerweit


manche biotechfirmen züchten ausgestorbene pflanzenarten so nebenbei nach.
Es gibt Personen, Menschen, Firmen, Botanische gärten, organisationen, die in vitro (hinter glas) /aus petrischalen ausgestorbene pflanzenarten nachzüchten.
„cloning extinct species“
„clone extinct plants“
Zellkulturen
Organogenese
Viel besser: was macht die natur selber (im moment auch durch mich)
Auf dem englischen wikipiedia gibt es eine liste von (bereits ausgestorbenen?) tieren die geklont wurden


(ein bioinformatiker würde das regelkreis nennen):
das Legeverhalten der Malaria übertragenden Anophelesmücke
wird
von Phytopheromonen beeinflusst. Wenn die pflanzen für die
moskito zu sehr stinken,
legt sie dort ihre eier nicht ab und die gegend bleibt von malaria
verschont.
Malaria: mal air ~ schlechte luft.
))Prof.Dr.Hugo Glaser/dramatische Medizin


die Zoochorie,
die Ausbreitung durch Tiere
  • die Semachorie,
    die Ausbreitung durch Wind- und Tierstreuung
oder mit seedballz aus dem automaten
· Speirochorie: die ungewollte Einführung durch verunreinigtes Saatgut
  • Agochorie
    die Einführung über ungewollten Transport
  • Barochorie
· Endochorie, die sogenannte Verdauungsausbreitung
· Myrmekochorie, die Ausbreitung durch Ameisen
· Ornithochorie, die Ausbreitung durch Vögel
· Dysochorie, die Zufallsausbreitung
Die Hydrochorie wird feiner unterteilt in
  • Bythisochorie,
    die Ausbreitung durch die Strömung von Fließgewässern
  • Ombrochorie,
    die Ausbreitung durch Regentropfen mit der Feineinteilung in

Autochorie

Die Mechanismen, die den Pflanzen zur Selbstausbreitung zur Verfügung stehen werden unter Autochorie zusammengefasst.
  • Ballochorie,
    der Ausbreitung durch Schleudermechanismen, die wiederum feiner
unterteilt wird in

Hemerochorie

  • Agochorie,
    die Ausbreitung durch unbeabsichtigten Transport
Endozoochorie (Diasporen werden gefressen und wieder ausgeschieden)
Epizoochorie (Diasporen haften der Körperoberfläche an)
· Bei der Calycobolie bricht der Kelch, der die Frucht umschließt, bei der Fruchtreife von der Rhachis ab und die ganze Frucht fällt zu Boden. Hier kann sie verweht werden oder bei schweren Früchten liegen bleiben.
· Bei der Synaptospermie fällt nicht eine einzelne Frucht, sondern der ganze Blütenstand mit mehreren Früchten herunter. Hierzu bricht er von der Sprossachse ab. Diese Fruchtstände sind üblicherweise zu schwer, um verweht zu werden.
· Bei der Aestatiphorie fällt die Frucht gar nicht herab, bis die Pflanze zerfällt. Hier bleibt die Frucht geschlossen.
· Basikarpie heißt der Fall, in dem die schweren Früchte den Blütenstand zu Boden drücken und dort keimen.
· Geokarpie schließlich ist ein besonderes Phänomen, dem dem einige sterile Blüten zu Bohrern umgebildet werden, die die fertilen Blüten einschließen und den Boden penetrieren. Dort reifen die Früchte heran und die Samen können
……………………………………………..
Oliver Tackenberg:
Methoden zur Bewertung gradueller Unterschiede des Ausbreitungspotentials von Pflanzenarten
Modellierung des Windausbreitungspotentials und regelbasierte Ableitung des Fernausbreitungspotentials
……………………………………………………….
http://de.wikipedia.org/wiki/Gaia-Hypothese
ecoinformatics
was sind bindende oder zwingende entscheidungen (z.B. baggerauftrag storniert, bagger Stopp, bagger nicht bauen, vorsicht aua! Pflanze schmerz,
bagger gar nicht erst losfahren, wir brauchen dieses wilde grundstück doch nicht roden, weil es insgesamt nicht sinnvoll und schädlich ist,
organismen der entscheidenden menschen beeinflusst von pflanzen und tieren um sie rum)
wann sind pflanzen stärker als maschinen,
sie sind auf jeden fall stärker als beton.keimlinge brechen langsam und in aller ruhe betonplatten auf.
nur in dem fall meines minidschungels gibt es ein mieses problem


. keimlinge und sämlinge treiben aus wie verrückt , sie "schießen" (nach den worten einer gartenbaumarkt-fachkraft weil sie zuviel wasser bekommen haben, weil das ding auf der heizung steht oder weil sie nicht im zimmer sondern draußen wachsen sollten, was alles in frage gestellt und anders betrachtet werden könnte)
und kippen dann nach ein paar tagen wieder um , eventuell weil sie ihr eigenes gewicht nicht mehr tragen können

das ist doch völlig unlogisch, unbiologisch, bio-UNLOGISCH, wenn mensch bedenkt daß saatgut (wie z.B. rapssaatgut) im boden 15 jahre keimfähig bleiben kann und DANN keimt wenn es AN DER ZEIT IST. ja, saatgut kann sogar mehrere jahrtausende keimfähig bleiben wenn es entsprechend gelagert ist...... d.h. der pflanzencode ist schon intelligent genug, zum passenden zeitpunkt auszutreiben.

also was ist da los ! ich bin empört und betroffen und habe neulich im fall einer auskeimenden olive der dasselbe schicksal drohte wie den anderen über 200 die es nicht geschafft haben, oh "wunderbare göttliche natur" (scheißbrutal manchmal, du kreationistischer evolutionsbiologe........) einen rettungsversuch gestartet.



von den 4 knoblauchzehen die ebenfalls rasend schnell und kräftig bis zu 10 zentimeter ausgetrieben waren habens nicht mal 2 geschafft einigermaßen am leben zu bleiben.
*****************************************************
und wieder hocke ich mich online in botanik

Vorlesung Botanik I, 32. Stunde

Title (alt.):Botanik: Einführung in Bau, Funktion und ökologische Anpassungen pflanzlicher Gewebe
Creator:Hampp, Rüdiger (author); Nehls, Uwe (author);
Subject:Botanik; Vorlesung; Blatt; Blätter; Telomtheorie; Keimblatt; Laubblatt; Monocotyledone; Dicotyledone; Bifaciales Laubblatt; 



******************************************************

systemtheorie
qualitätsanalyse> algorithmen >für möglichst viele lebewesen sinnvollste links
an nummer eins in SERPS, lebewesen nicht Priorität mensch sondern alle lebewesen
gleichberechtigt >global brain gaia>
interaktion und interfaces mit pflanzen
____________________________________________________________________
Margulis Laboratory
http://www.geo.umass.edu/margulislab/Margulis_Lab_Site/Welcome.html
Symbiogenetics
Environmental evolution
Origin of the eukaryotic cell
Microbial communities
Gaia Theory and Gaian Science
Evolution geography
Protistology
Biogeochemistry
Community in evolution
Microbialites
Cosmological cycles
Cosmic influences on Earth
________________________________________________________________________
http://de.wikipedia.org/wiki/Umweltpsychologie
saatgut bedrohter oder ausgestorbener pflanzenarten
fund von keimfähigem Saatgut in den Pyramiden von gizeh
::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
http://www.kew.org/science-conservation/kew-biodiversity/index.htm
‚’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’,.,.,.,.,.,.,.,,.,,,,..,,.,
Umweltethik und die Realität des Umwelthandelns am Beispiel
Klimaschutz.
Umweltwissenschaften und Schadstoffforschung -
Zeitschrift für Umweltchemie und Ökotoxikologie 16(4), S.
219 - 222 (2004) (ISSN 0934-3504)
  • Konrad
    Ott & Martin Gorke (Hrsg.): Spektrum der
    Umweltethik
    . Metropolis Verlag, Marburg 2000, ISBN
    3-89518-289-3
  • Angelika
    Krebs (Hrsg.): Naturethik. Grundtexte der
    gegenwärtigen tier- und ökoethischen Diskussion
    .

Suhrkamp Verlag, Frankfurt (Main) 1997, ISBN
3-518-28862-8
  • Dietmar v.d.

Pfordten: Ökologische Ethik. Zur Rechtfertigung menschlichen
Verhaltens gegenüber der Natur
. Rowohlt Verlag, Reinbek
  • Gerhard Pretzmann

(Hrsg.): Umweltethik. Manifest eines verantwortungsvollen Umgangs
mit der Natur
, Graz 2001.
  • Kirsten Meyer: Der
    Wert der Natur. Begründungsvielfalt im Naturschutz, Mentis,

Paderborn 2003.
  • Hangartner, Guido

(2002): Waldethik – Theologisch-ethische Überlegungen
zu Wald und Forstwirtschaft - Eine wissenschaftliche Arbeit im
Bereich der Umwelt- und Sozialethik
: München, Herbert
Utz-Verlag, ISBN
3-8316-0207-7
.
  • Peter
    Singer Praktische Ethik, Frankfurt 1994,

Bibliographisch ergänzte Ausgabe. Stuttgart 2001. ISBN
3-15-009983-8
http://de.wikipedia.org/wiki/Endemit
http://de.wikipedia.org/wiki/St.-Helena-Riesenohrwurm
statisch/mobil
……,.,.,,..,.,…………,,,,,,..,.,.,,,.,.,,,.,,.,,.,.,.,,..,.,
wie schnell wächst die pflanze
legt sich die pflanze nachts ins bett zum schlafen ?
gehen pflanzen spazieren?
Greencity/wanderbaumaktion
Mobilität je nach gesundheit und Alter
Lesen in einem Buch
Lesen im Wald
Lesen in der Vegetation
Lesen in den Blättern der Bäume
Schreiben mit Tinte oder Druckerfarbe
Schreiben mit körperflüssigkeiten durch ausscheidungen
Schreiben mit partikeln
Botanik in redewendungen
.,.,.,..,.,.,.,..,,.,,,,,,.,..,.,,.,.,..,,.,
den grünen finger haben
die grüne lunge wald
Vor sich hin vegetieren
auf bayrisch jemanden veräppeln: jemanden pflanzen
auf bayrisch sich hinsetzen: sich pflanzen
eine mimose sein 
querbeet

.....
-kritik ernten
-einen korb kriegen
-wenn die chemie stimmt (attraktiv sein (biologisch-chemisch))
sich zu jmd hingezogen fühlen
..................................................



insekten nutzen pflanzen als telefon, soviel ist klar, nur


wie ist die kommunikation zwischen pflanzen und menschen?
Das schweigen der Pflanzen
Sie nimmt frequenzen außerhalb des für menschen
Hör- und sichtbaren bereichs war
Sie ist langsamer und bewegt sich anders.
Sie bleibt lange zeit an einem ort verwurzelt
Ich bewundere sie, sie gibt gute luft und athmosphäre
Sie schützt vor stressigen vibes, nicht vor allen
Ich fühle mich in der natur, im park, an der isar, im wald wohl.
(((Bioinformatik)))
so würde es vielleicht aus der sicht eines computerprogramms aussehen:
(zu sachlich, zynisch, gefühllos, rational)
Gestorbene Menschen M
Auf Friedhöfen in Gitterkörbe geworfene Grabpflanzen
die noch leben und teilweise noch blühen P(G)
Häufigkeit von bestimmten Wörtern H(W)
Häufigkeit von Pflanzen H(P)
Bedrohte Arten B(A)
Ausgestorbene Arten A(A)
Häufigkeit von Begegnungen mit bestimmten Menschen H(M)
Häufigkeit von Verhaltensmustern H(V)
Verhältnis von M,P(G),H(W),H(P),B(A),A(A),H(M),H(V) zueinander
Good-turing reestimation
Algorithmen zur bestimmung der wortseltenheit
Exkurs: ubahnabteil X hält an einer bestimmten Stelle ich steige ein wo ich am bahnsteig stehe und begegne dort bestimmten leuten denen ich näher bin als den leuten in den anderen ubahnabteilen,
d.h. hier wird H(M) erhöht, von mehreren Faktoren beeinflusst
wer setzt sich gerne wo hin, wer steht lieber, wo bin ich als die ubahn einfährt usw.
Diskussionen rund um den anhalter bahnhof in berlin,
das ökosystem das dort aufgrund von güterwaggons
herabgefallenem saatgut aus aller welt entstanden ist
http://baumschutz.wordpress.com
http://www.berlin-gleisdreieck.de/Seiten/aktuelles/index.htm
http://gleisdreieck-blog.de/
räuber-beute-beziehungen in der evolutionsökologie
http://sci.bio.lmu.de/ecology/evol_e/people_laforsch_g.html
_________________________________________
Das texten selber als kybernetischer und ökologischer
Prozeß:
Ich als Teil der Natur schreibe mit dem und dem Gefühl,
schreibe das und das NICHT, je nachdem was mir/uns
wichtig erscheint, wenn es für Gaia bzw. die und die Wesen sinnvoll ist dass diese Inhalte da oder dorthin kommuniziert werden. Wenn ich mich soundso blöd fühle schreibe ich gar nix. Das entspricht dann auch der Strategie dieser oder jener
Pflanzen.
Ein besonderes Springkraut breitet sich im Sommer Herbst 2010 auf Terra in der Peripherie von München aus,
es ist zehnmal so hoch wie das altbekannte Springkraut,
blüht mit Lila löwenzahnmäulchen.
……
(Speisekarte auf botanisch)
Bestimmte pflanzen und knollen haben mein leben mehr beeinflusst als andere.
Tomaten, kartoffeln, zwiebeln, weizen, gerste, hopfen, tabak,
lauch, spinat, basilikum, oregano, soja, dinkel, paprika, schnittlauch, petersilie, (liste von hundert weiteren häufigen pflanzen)
Warum eigentlich.
Bestimmte wörter sagen wir sehr oft,
andere haben wir noch nie oder sehr selten gehört.
Gott kann 8000 sprachen gleichzeitig denken und sprechen

mahavira
Am besten du veränderst nichts, sonst zerquetschst du insekten oder zerknickst pflanzen.
Sie machen das alles selber viel besser und schöner.
JAIN


die schreie der vertrocknenden tomate

die schreie des gemüses im kochtopf

die  schreie des gemüses beim schälen, hörst du sie nicht ?

2010 wie 2002 mit den zwiebeln die ausgetrieben sind im keller:
 die entscheidung, die kohlrabi jetzt in den park zu schleppen und einzupflanzen oder zu zerschneiden und kochen bleibt bei dir.
der im park gepflanzte riesengroße rote kohlkopf war ein paar tage später verschwundibus. (trotz oder gerade wegen des darüber gesprochenen spezial-schamanensegens) (fluch=segen)

die vorstellung, mit jedem gekauften kohlrabi von dem noch blätter herabhängen in den park gehen zu müssen um ihn dort einzupflanzen , hat etwas schizophrenes und beklemmendes
wenn man sich gleichzeitig vorstellt
wieviel gemüse gleichzeitig noch eingesperrt in lagerhallen liegt.

andererseits tut einem der knoblauch auch leid, wenn man weiß daß eine eingepflanzte knoblauchzehe sofort
keimt und wächst.

ebenso die karotten.

wozu dann noch essen ?


:
die webcam zeichnet auf einmal im dunkeln auf wie blöd,
das heißt meine pflanze geht endlich ins netz. ----- restfantasie noch vorhanden ----- haben sie den film tron gesehen (ich meine das original von 1982) ? eine orange geht ins netz.
firefox müht sich mit einem mht format ab,
seit 20 minuten arbeitet firefox wie verrückt,
und das ist schön. es ist noch besser als die fehlermeldung 503 vorhin bei blogspot die sich durch einen umweg auf draft.blogger umgehen ließ.
danke leute.

möööööhööööhhhhhge die evolution entscheiden singt der alte gladiator aus seinem grab.

ich glaub nich dassss  da jemand aufmerksam darauf geworden ist dassssss
ich heute morgen noch
intensivste recherchen zum aktuellen stand des genetic engineering betrieben habe, warum nur.
ach das war nur so.

hei, genomeplex dich doch, organogenese.


genealogisch betrachtet,

wer hat die filmrechte morgen gekauft. ach, die wieder. na dann.


"ich muß das jetzt tun.
gctaggcatgatagtgctcagtcgatgcgcattgactagatctacgatgctcatgactgacatgcatatctcagatgatcatcatagtagactgactactgatcacgatgatcgatgagtagttatgactcatatgattatactagcatgacacatgcatc
schreibt mir das nunmal vor."
der film gattaca behandelt eben diesen determinismus der aus einem verzerrten biologistischen denken resultiert.

"ich kann nicht anders, weil tgactacgatcgatagcatcgactgcaccttatgactcggctcttctcttttattgtcgcatctcgtatctcagtcctgggctcgtctcatcgctacgat
behauptet,
skdjfgptü0qw4z8tü0hgösljhgösohgosihgüosiihgüosdhgüosdihgsdoifhsdopfhw08tz034tz0gh<üsoifghwü0tu90t90q38tüoiihgfüsoifjüeoi

wollte das so."
-----------------------------------------------------------------------
schon vorweggenommene kommentare (die eh nicht kommen, weil kaum jemand die motivation für diesen blogartikel versteht)

"irgendwas zusammenphantasiert"

"ich verstehe nicht was er meint"

"das ist mir alles viel zu kompliziert" (und tschüß)

"würg, so ein mieses layout" (und tschüß)

"das ist doch cloaking was der macht" (auf wiedersehen)

"ordne diesen text bitte"

"ein furchtbares durcheinander"

"viel zu wirr"

"ich hasse ihn"

"pseudowissenschaftlich"

"er will sich nur wichtig machen"

"noch nicht mal populärwissenschaftlich"

"seltsames wirres und zerfasertes Geschwalle"

"mir wird überhaupt nicht klar was das soll"

naja, wenigstens wird der text von crawlern und bots ausgewertet und verbindungen hergestellt
____________________________________________________________________________
update 5/2013:
March against Monsanto 25.5.2013

Go cruelty free

Rettet den Regenwald

Blogger gegen Tierversuche

Ärzte gegen Tierversuche

Ärzte gegen Tierversuche